Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_Circ6510-1 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Coronary arteryu disease, type 2 Diabetes mellitus | ICD-10 | Atherosclerotic cardiovascular disease, so described (I25) |
DBLink | Link to database | PMID | 28777011 |
Experimental Method | |||
Sample Type | Peripheral Blood Mononuclear Cells (PBMCs) | Comparison | peripheral blood from 6 control individuals, 6 coronary artery disease patients, 6 type 2 diabetes mellitus patients and 6 coronary artery disease combined with type 2 diabetes mellitus patients |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward ACATCAGGAGTGGTTCTCTGTGA ReverseTGTAGTCCTGAGTTAGCAAGGAGA | Statistics | Fold Change : Upregulated pvalue : p<0.001 |
Citation | |||
Li, X, Zhao, Z, Jian, D, Li, W, Tang, H, Li, M (2017). Hsa-circRNA11783-2 in peripheral blood is correlated with coronary artery disease and type 2 diabetes mellitus. Diab Vasc Dis Res, 14, 6:510-515. |